ABOUT Alex Brown

Avatar of Alex Brown

With a deep fascination for the way ideas are expressed, Alex Brown brings together the worlds of languages and science. Having been brought up bilingually and as a student of science & science communication, he likes to join the dots between concepts in different cultures.

Alex received his BSc Natural Sciences from the University of Bath, UK. His final year project was an investigation into the effects of bilingualism on scientific thought.

He has recently completed the MSc Science Communication at the University of the West of England, UK, with a focus on science writing and hands-on science communication. His thesis project was an evaluation of the schools outreach programme at STFC Rutherford Appleton Laboratory, UK.

He blogs about his other interests, namely volunteer student charity fundraising ("rag" in the UK) and the little-known sport of floorball, on his own website.

You can get in touch with Alex in English, French or German on Twitter at @alex_brovvn.

 

Alex Brown: All Posts

 
 

A storm in a tea cup, and then some.

Posted 23 February 2014 by Alex Brown

The other day, I was caught somewhat off-guard when I thought I had found entire Universe in a cup of coffee. I won't go so far as to compare my experience to Proust's "madeleine moment", but it certainly felt pretty philosophical... I am lucky enough to have the opportunity to travel a lot. I go by train, by plane, and, more recently, by driving myself around in my little car. Often, I do this alone. Especially when driving, I find myself going... Read more

Uphill of a magnet

Posted 4 February 2014 by Alex Brown

On not speaking French A lot of spoken French goes without saying. I don't mean that speaking it is easy or évident; I'm referring to the many silent letters in French words, especially in endings. It can be very challenging for someone learning French to know which letters to pronounce, and which to leave out. Even learning French "from English" (which also has many silent letters  - "through", anyone?), as opposed to "from German" (where almost everything is pronounced) can... Read more

Nomadus scientificus

Posted 26 January 2014 by Alex Brown

Whether it's collecting data in a specific environment, presenting results at a conference, or simply having to change jobs every 6-18 months until you get tenure, a life in science can mean moving around a lot. A while ago I cam across a listicle on Buzzfeed, "29 Truths About Growing Up In Multiple Cities". Although I only grew up in one city, I have since moved around a fair bit, for university and work. So there are quite a few of... Read more

Crabstrology

Posted 23 January 2014 by Alex Brown

(I don't usually feel the need to do this, but just in case: this post discusses (the etymology of the word) cancer and contains a moderately graphic image of a tumour, so if that's the kind of thing that might upset you, it may be best to switch to reading in HTML only or something else altogether.) It's written in the stars Astrology is a pretty weird set of ideas. The theory goes that the positions of far-off celestial bodies... Read more

Make attention to your assumptions

Posted 7 January 2014 by Alex Brown

“Science knows it doesn’t know everything, otherwise it would stop.” - Dara O’Briain In science, we use models to represent some part of the world in which we are interested. Some models are more sophisticated than others, leading to conclusions which are more or less likely to be valid. Because we can’t know about all aspects of the thing we are studying with infinite precision (more on “precision” versus “accuracy” in a future post), we have to assume certain unknown... Read more

#solo13 caption competition – the results

Posted 21 November 2013 by Alex Brown

I recently attended the SpotOn conference in London. As well as running a workshop, I set up a game of buzzword bingo, and a caption competition. Below are the results of the latter. You can read all the entries in the comments section under the competition post. Honourable mentions The following people came very close to winning: Eva Amsen, who added a slightly unflattering photo of me to the selection (though I am slightly proud of my laptop-as-tray sandwichbalancing skills)... Read more

CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC

Posted 21 November 2013 by Alex Brown

On Tuesday night, Fred Sanger died. For those of you not familiar with Sanger, suffice it to say for now that he was a very important scientist. He won two Nobel prizes (count.them.) for chemistry, though his work has had huge repercussions in biology and medicine. He pioneered the field of protein and, later, DNA sequencing. You can read more about his life and work in other places (eg a brief autobiography on the Nobel Prize website). What I want... Read more

Luftballonweitflugwettbewerb: conflicting

Posted 16 November 2013 by Alex Brown

I was recently introduced to a German word which I had never come across before: Luftballonweitflugwettbewerb. (thanks, 4TuneQkie) It's not in particularly common use (my online search engine turns up only about 5000 results). Nonetheless, I think it's a really fun word to say and wish it came up more in conversation. So like General Melchett, I'd like you to make a note of it, Darling. However, the thing it denotes is somewhat ... conflicting. Luftballonweitflugwettbewerb is a compound noun.... Read more

#solo13 Caption Competition

Posted 14 November 2013 by Alex Brown

[TL;DR: #solo13 caption competition and NEW photo-editing competition, deadline = 1pm CET on Thursday 21 November;  prize = postcard from CERN.] UPDATE: the deadline has passed. Thanks to everyone who took part. I'll go over the entries and come up with a winner soon. Last week, I was at the Science Policy, Outreach and Tools Online (SpotOn) conference in London. This post may not be of much interest to any of you who weren't also there. Why not read this... Read more

We did not go to space that day, but…

Posted 14 November 2013 by Alex Brown

As mentioned in a previous post, last week I ran a workshop at the Science Policy, Outreach and Tools Online (SpotOn) conference in London (also known as solo13). The aim of the session was to spark conversations about the use of jargon. To do this, we used the "Upgoer5" text editor to translate the abstract of a scientific paper using only the thousand most common English words, then discussed the challenge presented by the concept of "jargon" in online science... Read more