CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC

21 November 2013 by Alex Brown, posted in blogging

Picture of Fred Sanger

CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC

On Tuesday night, Fred Sanger died.

For those of you not familiar with Sanger, suffice it to say for now that he was a very important scientist. He won two Nobel prizes (count.them.) for chemistry, though his work has had huge repercussions in biology and medicine. He pioneered the field of protein and, later, DNA sequencing. You can read more about his life and work in other places (eg a brief autobiography on the Nobel Prize website). What I want to focus on here is not who he was or what he did, but rather how the science blogosphere deals with such a passing.

I first heard the news during a morning tea & twitter break at work, when Ed Yong tweeted:

CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC

A, C, T, G are the four nucleotides which make up DNA chains. Read three-by-three, they represent amino acids, which make up proteins, an incredibly important type of molecule making up all living things. Amino acids have their own code. The nucleotide triplet "CGC" translates to R (for arginine). "ATT" is I (isoleucine). "CCG" is P (proline). Can you see where this is going? If not, you can translate the sequence yourself using this website.

(This video gives an introduction to how Sanger sequencing works (at the technical level of about undergraduate biology))

Having studied some biology at university, I knew who Sanger was. He's up there with Crick, Franklin and Watson and Wilkins in terms of impact (they discovered the structure of DNA in the first place), if not in terms of fame. So, I was sad to hear of his death. But the world kept on turning and I got back to work, putting it to the back of my mind.

Seemingly unconnectedly, at lunch today I happened to be discussing the phenomenon of using English words in foreign-language scientific discussions with a colleague. I was reminded of a particular post of mine on this blog, and made a mental note to send it over via email. Re-reading the post this afternoon, I remembered that it also deals with DNA sequencing (specifically, it deals with the use of "to align sequences" in German).

I thought to myself

"Aha! Sanger just died, people will have sequencing on their minds. How convenient that I just so happen to have this post that deals with that very subject! I should promote it on Twitter! Just think of the sweet, sweet hits! People will read my blog and I will feel good! They might even learn something or offer me book deal or WHO KNOWS?!"

But I re-considered. The scientific community is in mourning. Wouldn't it be crass for me to say "Hey, this is a news hook for me to recycle an old post on!"?

My sequencing post is not about Sanger. It doesn't mention him. in fact, I'm not even sure when I last thought about Sanger. The legacy of his work comes up a lot, of course, but the man himself? He would have come to mind a couple of times in the last couple of years (since I finished my undergraduate biology courses). Once when I saw a job advert from the institute that bears his name, and another couple of times when I have visited the Wellcome Collection in London, where they had (have?) an old-school sequencing machine on display..

But will I miss him as a person? No, of course not. I never met him. But I still think there are right and wrong ways of dealing with the death of a  prominent member of this community of which I am part. In a "6 degrees of Kevin Bacon" sense, I probably have a Sanger number of 2 if we go by "met at least once" for our connections, and probably no more than 3 if we use "close friend, classmate, professor or colleague". And somehow, it seems insensitive for me to say "Look at me! Aren't I clever?!" right now.

Similarly, when Neil Armstrong died in 2012, many quickly used the opportunity to call for more funding for manned space exploration. Was that appropriate? Although Armstrong was on record as supporting that cause, was it perhaps too soon to point that out? I'm not completely sure either way.

Writing tributes and obituaries is one thing, and advocating for certain relevant causes may also be passable, but to take advantage of someone's death for self-promotion? That seems a bit off to me. And yet here I am, writing this, purely because Fred Sanger died. You can bet I'll be promoting it on Twitter. The world goes on.

Further reading:

Over to you:

  • Have you written a tribute to Sanger?
  • What do you think is appropriate online behaviour in these cases? Am I being overly sensitive?

 

 


2 Responses to “CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC”

  1. Nick Reply | Permalink

    Yes, I think you are being over-sensitive. The online community does not mourn like a family does. When someone famous dies, especially in retirement, the press covers their life's work straight away. I would only worry if he had been an ongoing active member of my specific online community right up until his death.

Leave a Reply


seven − 6 =